Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 690569
End position: 690595
Length: 27

DNA sequence
>NC_020895, from 690569 to 690595 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCTGCGTGTTCTGCGTGTTCTGGGTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 690517-691686	Sequence	SHJGH_0573 - oxidoreductase (Protein is coded in complementary strand; from 691686 to 690517)