Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6974360
End position: 6974386
Length: 27

DNA sequence
>NC_020895, from 6974360 to 6974386 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGAGCGGGGGGAGCGGACGGAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6973552-6974412	Sequence	SHJGH_6158 - N,O-diacetyl muramidase (Protein is coded in complementary strand; from 6974412 to 6973552)