Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7292537
End position: 7292563
Length: 27

DNA sequence
>NC_020895, from 7292537 to 7292563 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCTCCTCGGCCTCCTCGGCCTCCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7292224-7295253	Sequence	SHJGH_6441 - hypothetical protein (Protein is coded in complementary strand; from 7295253 to 7292224)