Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7761398
End position: 7761424
Length: 27

DNA sequence
>NC_020895, from 7761398 to 7761424 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTCCCCGAGGTCCCCGAGCTCCCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7761396-7764089	Sequence	SHJGH_6831 - magnesium or manganese-dependent protein phosphatase (Protein is coded in complementary strand; from 7764089 to 7761396)