Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7765179
End position: 7765205
Length: 27

DNA sequence
>NC_020895, from 7765179 to 7765205 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCGGCCTGACCGGTCTGGCCGGCCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7765096-7766988	Sequence	SHJGH_6833 - putative heat shock protein HSP70 (Protein is coded in complementary strand; from 7766988 to 7765096)