Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7788663
End position: 7788689
Length: 27

DNA sequence
>NC_020895, from 7788663 to 7788689 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGCCGCCGGGGCCGCCGTCGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7788166-7789620	Sequence	SHJGH_6847 - hypothetical protein