Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7819641
End position: 7819667
Length: 27

DNA sequence
>NC_020895, from 7819641 to 7819667 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCTCCGGCTTCTCCGGCTTCTCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7819585-7820454	Sequence	SHJGH_6875 - hypothetical protein (Protein is coded in complementary strand; from 7820454 to 7819585)