Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8191085
End position: 8191111
Length: 27

DNA sequence
>NC_020895, from 8191085 to 8191111 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGAAGCGGGAGAAGAGGGAGAAGAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8190199-8191398	Sequence	SHJGH_7222 - hypothetical protein