Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 830039
End position: 830065
Length: 27

DNA sequence
>NC_020895, from 830039 to 830065 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCGAGTACGGCGAGTACGGCGAGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 829827-830168	Sequence	SHJGH_0710 - hypothetical protein (Protein is coded in complementary strand; from 830168 to 829827)