Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 890816
End position: 890842
Length: 27

DNA sequence
>NC_020895, from 890816 to 890842 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTCGGCGCGGTCGGCGCGGTCGGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 890328-890972	Sequence	SHJGH_0765 - hydrolase (Protein is coded in complementary strand; from 890972 to 890328)