Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9211662
End position: 9211688
Length: 27

DNA sequence
>NC_020895, from 9211662 to 9211688 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGTCGCCGCGGTGGCCACGGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9210448-9211899	Sequence	SHJGH_8070 - hypothetical protein