Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9226234
End position: 9226260
Length: 27

DNA sequence
>NC_020895, from 9226234 to 9226260 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGGCACACATGGCGCACATGGCGCACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9225898-9226578	Sequence	SHJGH_8083 - hypothetical protein