Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9286599
End position: 9286625
Length: 27

DNA sequence
>NC_020895, from 9286599 to 9286625 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CTCCGGGCTCTCCGGGCGCCCCGGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9286583-9287770	Sequence	SHJGH_8139 - dioxygenase subunit (Protein is coded in complementary strand; from 9287770 to 9286583)