Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9763754
End position: 9763780
Length: 27

DNA sequence
>NC_020895, from 9763754 to 9763780 (27 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAAGGGCAACGAGGGCAACAACGGCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9763597-9764142	Sequence	SHJGH_8568 - hypothetical protein