Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3446041
End position: 3446068
Length: 28

DNA sequence
>NC_020895, from 3446041 to 3446068 (28 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCGCCCGCCGCACGCCGACCGCCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3445088-3446113	Sequence	SHJGH_2966 - integral membrane protein