Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5282332
End position: 5282359
Length: 28

DNA sequence
>NC_020895, from 5282332 to 5282359 (28 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTTACGGCTTATGGCTTACGGCTTACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5282356-5283036	Sequence	SHJGH_4626 - putative two-component system response regulator (Protein is coded in complementary strand; from 5283036 to 5282356)