Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1032418
End position: 1032447
Length: 30

DNA sequence
>NC_020895, from 1032418 to 1032447 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCCGCCCTGCCCCGCCCTGCCTCGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 1031030-1032418	Sequence	SHJGH_0889 - amino acid permease-associated region