Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1139670
End position: 1139699
Length: 30

DNA sequence
>NC_020895, from 1139670 to 1139699 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGTGCTGGTGCTGGTGCTGGTGCTGGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1132699-1142553	Sequence	SHJGH_0968 - non-ribosomal peptide synthase-polyketide