Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1790623
End position: 1790652
Length: 30

DNA sequence
>NC_020895, from 1790623 to 1790652 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGCACGGCACGGCACGGCACGGCACGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1790602-1790901	Sequence	SHJGH_1494 - hypothetical protein