Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2496958
End position: 2496987
Length: 30

DNA sequence
>NC_020895, from 2496958 to 2496987 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGACCGCCACCGCGACCGCGCCCGCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2496550-2497410	Sequence	SHJGH_2093 - SCP-like extracellular