Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2571784
End position: 2571813
Length: 30

DNA sequence
>NC_020895, from 2571784 to 2571813 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACCCGGACGGGCCCGGCCGGACCGGGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2571510-2571878	Sequence	SHJGH_2157 - hypothetical protein (Protein is coded in complementary strand; from 2571878 to 2571510)