Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2800476
End position: 2800505
Length: 30

DNA sequence
>NC_020895, from 2800476 to 2800505 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACGGCGACGGCATCGGCGACTGCGACGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2800227-2800694	Sequence	SHJGH_2358 - hypothetical protein