Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3592412
End position: 3592441
Length: 30

DNA sequence
>NC_020895, from 3592412 to 3592441 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGAGCGCGAGCGCGAGCGCGAGCGCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3592304-3592696	Sequence	SHJGH_3104 - GntR-family transcriptional regulator (Protein is coded in complementary strand; from 3592696 to 3592304)