Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3717251
End position: 3717280
Length: 30

DNA sequence
>NC_020895, from 3717251 to 3717280 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGACCCCGACCGCGCCCGCGCCCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3716669-3717370	Sequence	SHJGH_3222 - GntR-family transcriptional regulator