Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3802297
End position: 3802326
Length: 30

DNA sequence
>NC_020895, from 3802297 to 3802326 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGGCGGCTGGCAGTGGCTGGCGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3800821-3802398	Sequence	SHJGH_3298 - hypothetical protein