Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3815152
End position: 3815181
Length: 30

DNA sequence
>NC_020895, from 3815152 to 3815181 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTGCCCCGCCCGGCCCCGCGCCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3814572-3815252	Sequence	SHJGH_3309 - hypothetical protein