Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 386047
End position: 386076
Length: 30

DNA sequence
>NC_020895, from 386047 to 386076 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GACGGCCGCGCCCGGCCGCGCCCGGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 383002-386049	Sequence	SHJGH_0307 - LuxR-family transcriptional regulator