Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 3940157
End position: 3940186
Length: 30

DNA sequence
>NC_020895, from 3940157 to 3940186 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCGCCGTGGCCGCCGCCGTCGCCGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3939482-3940303	Sequence	SHJGH_3422 - cobalamin (5'-phosphate) synthase