Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4829011
End position: 4829040
Length: 30

DNA sequence
>NC_020895, from 4829011 to 4829040 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCCCCCGCCGTTCCCCGGCGCCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4828902-4830344	Sequence	SHJGH_4226 - integral membrane protein (Protein is coded in complementary strand; from 4830344 to 4828902)