Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5310525
End position: 5310554
Length: 30

DNA sequence
>NC_020895, from 5310525 to 5310554 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GTGGTGGAGGTGGTGGAGGTGGTGGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5310495-5311115	Sequence	SHJGH_4656 - hypothetical protein (Protein is coded in complementary strand; from 5311115 to 5310495)