Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5458587
End position: 5458616
Length: 30

DNA sequence
>NC_020895, from 5458587 to 5458616 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCGTACCCGCACCCGCACCCGCACCGGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5457680-5459917	Sequence	SHJGH_4787 - integral membrane protein (Protein is coded in complementary strand; from 5459917 to 5457680)