Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5706352
End position: 5706381
Length: 30

DNA sequence
>NC_020895, from 5706352 to 5706381 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CCCGGGCCGTCCCGGGCGGTCCCGGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 5706382-5707227	Sequence	SHJGH_5014 - hypothetical protein (Protein is coded in complementary strand; from 5707227 to 5706382)