Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 5878372
End position: 5878401
Length: 30

DNA sequence
>NC_020895, from 5878372 to 5878401 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCGGCCCCGGCCACGGCCCCGGCCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5877893-5878642	Sequence	SHJGH_5167 - hypothetical protein (Protein is coded in complementary strand; from 5878642 to 5877893)