Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 594256
End position: 594285
Length: 30

DNA sequence
>NC_020895, from 594256 to 594285 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCGGGCGCGCCGGGGCGCGGCCGGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 594170-594730	Sequence	SHJGH_0487 - hypothetical protein (Protein is coded in complementary strand; from 594730 to 594170)