Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6445118
End position: 6445147
Length: 30

DNA sequence
>NC_020895, from 6445118 to 6445147 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCAGCCGGTCGCGGTCGGTCCCTGCCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6440822-6447988	Sequence	SHJGH_5690 - non-ribosomal peptide synthase (Protein is coded in complementary strand; from 6447988 to 6440822)