Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6507549
End position: 6507578
Length: 30

DNA sequence
>NC_020895, from 6507549 to 6507578 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCACCGGCACAGGCACCCGCACCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 6507100-6508416	Sequence	SHJGH_5734 - integral membrane protein