Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7678053
End position: 7678082
Length: 30

DNA sequence
>NC_020895, from 7678053 to 7678082 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCGAGGGCGAGCCCGAGGACGAGGCCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7677333-7678853	Sequence	SHJGH_6763 - hypothetical protein (Protein is coded in complementary strand; from 7678853 to 7677333)