Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 8866
End position: 8895
Length: 30

DNA sequence
>NC_020895, from 8866 to 8895 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGTGGCGGGCTGTGGGCGGCTGTGGCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 8766-9845	Sequence	SHJGH_0008 - hypothetical protein (Protein is coded in complementary strand; from 9845 to 8766)