Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9109403
End position: 9109432
Length: 30

DNA sequence
>NC_020895, from 9109403 to 9109432 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGCAGGGGCTGGGGGAGGGGGAGGGACAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9109017-9109997	Sequence	SHJGH_7972 - NLP/P60 family secreted protein (Protein is coded in complementary strand; from 9109997 to 9109017)