Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9141589
End position: 9141618
Length: 30

DNA sequence
>NC_020895, from 9141589 to 9141618 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TGCGGAGCGGTGCGGCGGGGGCCGGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9141570-9142517	Sequence	SHJGH_8002 - exopolyphosphatase (Protein is coded in complementary strand; from 9142517 to 9141570)