Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 9263815
End position: 9263844
Length: 30

DNA sequence
>NC_020895, from 9263815 to 9263844 (30 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGCTGACCACGGCGAACCACGGCTGACGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 9262852-9263841	Sequence	SHJGH_8119 - 2-hydroxy-3-carboxy-6-oxo-7-methylocta-2, 4-dienoate decarboxylase