Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2181479
End position: 2181511
Length: 33

DNA sequence
>NC_020895, from 2181479 to 2181511 (33 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CAGACCGTCCTCAGACCGCCGTCAGACTGTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2181512-2181730	Sequence	SHJGH_1797 - hypothetical protein (Protein is coded in complementary strand; from 2181730 to 2181512)