Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 4531559
End position: 4531591
Length: 33

DNA sequence
>NC_020895, from 4531559 to 4531591 (33 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGTCGGCTGGTCGTCAGCTGGTCGTCGGCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 4531573-4531881	Sequence	SHJGH_3968 - hypothetical protein (Protein is coded in complementary strand; from 4531881 to 4531573)