Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 6924020
End position: 6924052
Length: 33

DNA sequence
>NC_020895, from 6924020 to 6924052 (33 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCTCACTCCCCGCCCACTCCTCGCTCACTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 6924045-6925043	Sequence	SHJGH_6115 - RNA polymerase sigma factor SigH (Protein is coded in complementary strand; from 6925043 to 6924045)