Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 7207749
End position: 7207781
Length: 33

DNA sequence
>NC_020895, from 7207749 to 7207781 (33 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GCCCGGCGCCCGGACGGCGCCCGCCGCGCGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 7207253-7208251	Sequence	SHJGH_6364 - oxidoreductase (Protein is coded in complementary strand; from 7208251 to 7207253)