Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 1197837
End position: 1197872
Length: 36

DNA sequence
>NC_020895, from 1197837 to 1197872 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 ACGCCGTCGTCCGCGCCGTCGTCCGCGCCGTCGTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1197648-1197896	Sequence	SHJGH_1022 - acyl carrier protein (Protein is coded in complementary strand; from 1197896 to 1197648)