Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2495578
End position: 2495613
Length: 36

DNA sequence
>NC_020895, from 2495578 to 2495613 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 TCTCGTCTGTGGTCTCGTCCGTCGTCTCGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2495565-2495720	Sequence	SHJGH_2091 - hypothetical protein (Protein is coded in complementary strand; from 2495720 to 2495565)