Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2510379
End position: 2510414
Length: 36

DNA sequence
>NC_020895, from 2510379 to 2510414 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 AGGGCGTCGAGCAGGGTGTCGAGACGGGCGTCGATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2510265-2512337	Sequence	SHJGH_2107 - putative magnesium or manganese-dependent protein (Protein is coded in complementary strand; from 2512337 to 2510265)