Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2585576
End position: 2585611
Length: 36

DNA sequence
>NC_020895, from 2585576 to 2585611 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 CGCCCTCGCCCGCGCCTTCGCCCGCGCCCTCGCCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2584958-2585785	Sequence	SHJGH_2167 - hypothetical protein