Sequence retrieval

Genome: Streptomyces hygroscopicus subsp. jinggangensis TL01
Start position: 2679434
End position: 2679469
Length: 36

DNA sequence
>NC_020895, from 2679434 to 2679469 (36 bp); Streptomyces hygroscopicus subsp. jinggangensis TL01 GGGGGCGGCGGGGCGGGCGGCGCGGTGGGCGGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2678801-2680015	Sequence	SHJGH_2246 - tellurium resistance protein (Protein is coded in complementary strand; from 2680015 to 2678801)